Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Phospholipase Cγ1 ( PLC γ1) is required for Notch1 cleavage stimulated by angiotensin II (Ang II ) and platelet‐derived growth factor ( PDGF ). A through D, Rat aortic smooth muscle cells ( RASMC s) were treated with 200 nmol/L Ang II for different time (A and C) or different dose of Ang II for 1 hour (B and D). Notch1 intracellular domain (N1‐ ICD ), FL ‐Notch1, and β‐actin expression were measured by Western blot. Notch1 cleavage (measured by N1‐ ICD /Notch1) after Ang II stimulation was quantified (mean± SEM , n=3) (C and D). * P <0.05 vs the cells not treated with Ang II. E through H, RASMC s were treated with 20 ng/mL of PDGF for different time (E and G) or different dose of PDGF for 1 hour (F and H). N1‐ ICD , FL ‐Notch1, and β‐actin expression were measured by Western blot. Notch1 cleavage (measured by N1‐ ICD /Notch1) after PDGF stimulation was quantified (mean± SEM ) (G and H). * P <0.05 vs the cells not treated with PDGF . I and J, RASMC s were transfected with control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) for 48 hours followed by stimulation of Ang II (200 nmol/L, E) or PDGF (20 ng/mL, F) for 1 hour. N1‐ ICD , FL ‐Notch1, N2‐ ICD , FL ‐Notch2, t‐ PLC γ1, and β‐actin expression were measured by Western blot. K, PLC γ1 protein levels were quantified (normalized to β‐actin after small interfering RNA knockdown) (mean± SEM , n=3). # P <0.05 vs the siCtr group. L and M, Notch1 cleavage was quantified by N1‐ ICD normalized to FL ‐Notch1 (mean± SEM , n=3). * P <0.05 vs the siCtr group. # P <0.05 vs the siCtr+ PDGF group. Experiments were performed in triplicate.

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Derivative Assay, Expressing, Western Blot, Transfection, Control, Small Interfering RNA, Knockdown

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Phospholipase Cγ1 ( PLC γ1) depletion suppresses Hey2 expression stimulated by angiotensin II (Ang II ) and platelet‐derived growth factor ( PDGF ). A through C, Representative immunoblot (A) and quantitative results (C) of Hey2 expression after PLC γ1 depletion. Rat aortic smooth muscle cells ( RASMC s) were transfected with control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) for 48 hours and then stimulated by Ang II (200 nmol/L). PLC γ1 levels were quantified after small interfering RNA (siRNA) knockdown (normalized to β‐actin) (B). D through F, Representative immunoblot (D) and quantitative results (F) of Hey2 expression induced by PDGF after PLC γ1 depletion. RASMC s were transfected with siCtr or si PLC γ1 for 48 hours and then stimulated by PDGF (20 ng/mL). PLC γ1 levels were quantified after si RNA knockdown (normalized to β‐actin) (E). All experiments were performed in triplicate. Quantification of Hey2 was normalized to β‐actin (mean± SEM , n=3). * P <0.05 vs the siCtr group at baseline. # P <0.05 vs the siCtr group with Ang II or PDGF treatment at the same time point.

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Expressing, Derivative Assay, Western Blot, Transfection, Control, Small Interfering RNA, Knockdown

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Phospholipase Cγ1 ( PLC γ1)–mediated Akt activation is essential for Notch1 cleavage. A through G, Representative immunoblot and quantification of Akt phosphorylation (p‐Akt) on S473 and T308 after PLC γ1 depletion. Rat aortic smooth muscle cells ( RASMC s) were transfected with control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) for 48 hours and then stimulated by angiotensin II (Ang II ; 200 nmol/L, A, D, and E) or platelet‐derived growth factor ( PDGF ; 20 ng/mL, B, F, and G) for 5 minutes. PLC γ1 levels were quantified after small interfering RNA (si RNA ) knockdown (normalized to β‐actin) (C). P‐Akt phosphorylation on S473 and T308 were quantified after small interfering RNA knockdown (normalized to total Akt) (D through G). Bars indicate mean± SEM . * P <0.05 vs the siCtr group. # P <0.05 vs the siCtr with Ang II or PDGF treatment. H, The binding of PLC γ1 and Akt was assayed by immunoprecipitation ( IP ) with t‐Akt antibody and probing for t‐ PLC γ1. Serum‐starved RASMC s were treated with vehicle, 200 nmol/L Ang II , or 20 ng/mL PDGF for 5 minutes. Then cell lysate was collected for IP assay. I and J, The binding of PLC γ1 and mammalian target of rapamycin ( mTOR ) (I) or 3‐phosphoinositide‐dependent protein kinase‐1 ( PDK 1) (J) was assayed by IP with mTOR antibody or PDK 1 antibody and probing for PLC γ1 in RASMC s. K through M, Akt activation after overexpression of phospholipase site–mutated PLC γ1 (H335F and H380F) was assayed in PLC γ1 knockdown human embryonic kidney 293T cells. Effects of Akt or Notch inhibitors on PLC γ1 and p‐Akt and Notch1 cleavage induced by Ang II (N) or PDGF (O). RASMC s were pretreated with 1 μmol/L wortmannin (Wort) and 10 μmol/L N‐[N‐(3,5‐Difluorophenacetyl)‐L‐alanyl]‐S‐phenylglycine t‐butyl ester (DAPT) for 12 hours and then incubated with Ang II (200 nmol/L) or PDGF (20 ng/mL). All experiments were performed in triplicate. DMSO indicates dimethyl sulfoxide; WT, wild‐type; MUT, mutant.

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Activation Assay, Western Blot, Phospho-proteomics, Transfection, Control, Small Interfering RNA, Derivative Assay, Knockdown, Binding Assay, Immunoprecipitation, Over Expression, Incubation, Mutagenesis

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Effects of phospholipase Cγ1 ( PLC γ1) knockdown on proliferation, migration, differentiation, and apoptosis in rat aortic smooth muscle cells ( RASMC s). A and B, Representative immunoblot and quantification of PLC γ1 in RASMC s after transfection with control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) for 48 hours. C, RASMC s are transfected with siCtr and si PLC γ1 for 48 hours. Then proliferation was assayed by MTS in the presence or absence of platelet‐derived growth factor ( PDGF ; 20 ng/mL) at the indicated time points. D and E, After transfection with siCtr or si PLC γ1 for 48 hours, cell migration was assessed by scratch wound assay in RASMC s with or without PDGF (20 ng/mL) stimulation for 24 hours. Wound area was analyzed by ImagePro Plus software. F and G, Representative flow cytometry images and statistical results show apoptosis ratio of serum‐starved RASMC s pretreated with siCtr or si PLC γ1. H and I, Representative images and statistical results show ratio of serum‐starved RASMC s with activated caspase‐3/7 pretreated with siCtr or si PLC γ1. White arrows indicate green nuclear signals of RASMC s in which caspase‐3/7 was activated and cleaved DEVD peptide so that DNA ‐binding dye conjugated to DEVD was released and stained the nucleus. J, Quantification of the mRNA levels of VSMC differentiation marker genes by real‐time polymerase chain reaction. Each experiment was repeated at least 3 times. Bars indicate mean± SEM . * P <0.05 vs the siCtr group. # P <0.05 vs the siCtr+PDGF group.

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Knockdown, Migration, Western Blot, Transfection, Control, Small Interfering RNA, Derivative Assay, Scratch Wound Assay Assay, Software, Flow Cytometry, Binding Assay, Staining, Marker, Real-time Polymerase Chain Reaction

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Phospholipase Cγ1 ( PLC γ1) depletion attenuates intima formation after vessel injury. A, Representative immunoblot of PLC γ1 in sham and ligated carotid arteries 3 days after ligation. B, Quantification of PLC γ1 phosphorylation in carotid arteries on day 3 after ligation. Bars indicate mean± SEM . * P <0.05 vs the sham group. C through E, Representative immunohistochemical staining and quantification of PLC γ1 on day 3 or day 7 after control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) delivery periadventitially in pluronic gel. Black arrows indicate smooth muscle cells in the media layer. Images were analyzed and PLC γ1 expression was quantified by fold changes of the average optical density ( AOD ) of staining. F, Representative cross sections of carotid arteries on day 21 (hematoxylin and eosin staining). siCtr or si PLC γ1 were delivered periadventitially in pluronic gel. Black line indicates intimal width. G through I, Quantification of intimal area (G), medial area (H), and intima/media (I/M) ratio (I) of carotid arteries on day 21 (mean± SEM , siCtr: n=10, si PLC γ1: n=9). J, Immunostaining of proliferating cell nuclear antigen (PCNA) in ligated carotid arteries transfected with siCtr or si PLC γ1 on day 21. Red arrows indicate PCNA ‐positive cells. K, PCNA ‐positive cells were quantified by examining every section of 5 sections in each artery (mean± SEM , n=5). * P <0.05 vs the siCtr group. L, Terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) staining of ligated carotid arteries transfected with siCtr or si PLC γ1 for day 21. Red arrows indicate TUNEL ‐positive cells. M, TUNEL ‐positive cells were quantified by examining every section of 5 sections in each artery (mean± SEM , n=5). * P <0.05 vs the siCtr group.

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Western Blot, Ligation, Phospho-proteomics, Immunohistochemical staining, Staining, Control, Small Interfering RNA, Expressing, Immunostaining, Transfection, End Labeling, TUNEL Assay

Journal: Journal of the American Heart Association: Cardiovascular and Cerebrovascular Disease

Article Title: Phospholipase Cγ1 Mediates Intima Formation Through Akt‐Notch1 Signaling Independent of the Phospholipase Activity

doi: 10.1161/JAHA.117.005537

Figure Lengend Snippet: Phospholipase Cγ1 ( PLC γ1) is critical for Akt and Notch1 activation in the carotid artery after ligation. A, Representative immunoblot of Akt phosphorylation (p‐Akt) in carotid arteries transfected with control small interfering RNA (siCtr) or PLC γ1 small interfering RNA (si PLC γ1) 7 days after ligation. B, Quantification of PLC γ1 protein levels after small interfering RNA knockdown on day 7 (normalized to β‐actin) (mean± SEM ). C, Quantification of p‐Akt in carotid arteries on day 7 (mean± SEM , n=5). D, Immunostaining of Notch1 intracellular domain (N1‐ ICD ) in ligated carotid arteries on day 21. Red arrows indicate N1‐ ICD –positive cells. E, N1‐ ICD –positive cells were quantified by examining every section of 5 sections in each artery (mean± SEM , n=5). F, Immunohistochemistry of Hey2 in carotid arteries on day 21. G, Hey2 expression was quantified by examining every section of 5 sections in each artery (mean± SEM , n=5). * P <0.05 compared with the siCtr group. # P <0.05 compared with the siCtr+ PDGF group in (B, D, and F).

Article Snippet: Passages 4 to 8 were used for experiments. siRNA specific for rat PLCγ1 (CAGTCATCCTGTCCATCGA) and control siRNA (siCtr) (ATCTCCGAACGTGTCACGATT) were transfected into RASMCs at 100 nmol/L using HiPerFect Reagent (Qiagen).

Techniques: Activation Assay, Ligation, Western Blot, Phospho-proteomics, Transfection, Control, Small Interfering RNA, Knockdown, Immunostaining, Immunohistochemistry, Expressing

Journal: Cell Death & Disease

Article Title: Melanophilin-induced primary cilia promote pancreatic cancer metastasis

doi: 10.1038/s41419-025-07344-2

Figure Lengend Snippet: A , B PLCG1 was activated in -QQ PANC-1 cells. A Phosphorylated PLCG1 increased as shown by human phospho-kinase array analysis in Prt and -QQ PANC-1 cells. The red line shows reference spots, whereas the blue line indicates the phosphorylation of Y783 of PLCG1. B PLCG1 was phosphorylated at tyrosine 783 in -QQ cells. Extracts of parental (Prt) or -QQ PANC-1 cells were analyzed by western blot assay with antibodies against phosphorylated PLCG1 at Y783, PLCG1, and tubulin. C The PLCG1 mRNA level increased in -QQ cells. Quantitative results of relative phospholipase C family mRNA levels were analyzed by qPCR in Prt or -QQ PANC-1 cells. D – F PLCG1 promoted EMT, cell migration, and invasion. D Depletion of PLCG1 alleviated EMT in -QQ cells. Extracts of -QQ PANC-1 cells transfected with siRNA against PLCG1 (siPLCG1) were analyzed by western blot assay with antibodies against PLCG1, E-cadherin (E-cad), and Ku70. E , F Depletion of PLCG1 alleviated cell migration and invasion of -QQ cells. Quantitative results of the relative ( E ) migrated and ( F ) invaded cell numbers in Prt or -QQ PANC-1 cells in the presence or absence of siRNA against PLCG1 (siPLCG1). G Depletion of IFT88 decreased PLCG1 expression. Extracts of -QQ PANC-1 cells in the absence or presence of siRNA against IFT88 (siIFT88) were analyzed by western blot assay with antibodies against phosphorylated PLCG1 (Y783), PLCG1, and Ku70. H MLPH depletion decreased PLCG1 expression and restored EMT. Extracts of -QQ-shScr or -QQ-shMLPH#1 or #2 PANC-1 cells were analyzed by western blot assay with antibodies against MLPH, PLCG1, E-cadherin (E-cad), and actin. I – J PLCG1 and phosphorylated PLCG1 at Y783 (p-PLCG1) localized to the primary cilia. Immunofluorescence staining of Prt or -QQ PANC-1 cells with antibodies against acetylated tubulin (Ac-tub) and ( I ) p-PLCG1 and ( J ) PLCG1. DNA was stained with DAPI (blue). Scale bar, 10 µm. K Depletion of PLCG1 inhibited primary ciliogenesis. Quantitative results of the frequency of ciliated cells of Prt or -QQ PANC-1 cells were shown in the presence or absence of siRNA against PLCG1 (siPLCG1). L Graphic abstract. When PDAC cells suffered a Gln deprivation condition, MLPH was upregulated and recruited to the centrosome to facilitate primary ciliogenesis. The primary cilia induced and activated PLCG1 to promote EMT, invasion, and metastasis. Besides, PLCG1 was recruited to the primary cilia, thereby feedforward maintaining primary ciliogenesis. Data are represented as the mean ± SD of three independent experiments. n.s. no significance, * P < 0.05, *** P < 0.001.

Article Snippet: Anti-IFT88 (13967-1-AP), anti-ARL13B (17711-1-AP), anti-MLPH (10338-1-AP), and anti-MMP9 (10375-2-AP) antibodies were purchased from Proteintech (Chicago, IL, USA). anti-CEP164 (NBP1-81445) and anti-myosin 5a (NBP1-92156) antibodies were purchased from Novus (Littleton, CO, USA). anti-β-actin (AC-15; GTX26276) and anti-PLCγ-1 (phospho-Y783; GTX24828) were purchased from GeneTex (Irvine, CA, USA).

Techniques: Western Blot, Migration, Transfection, Expressing, Immunofluorescence, Staining

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: Expression of PLCγ1 in MII-arrested mouse eggs, and schematic representation of the bacterial fusion proteins containing different PLCγ1 domains. In the schematic representation of PLCγ1 on the top of this figure, brackets identify the regions of PLCγ1 recognized by the two antibodies used for microinjection experiments shown in Table . PH , pleckstrin homology domain; Ca 2 + , EF-hand domain (calcium binding motif); X and Y , split catalytic domain; P and H , split pleckstrin homology domain; SH2 and SH3 , src-homology domains; C2 , Ca 2+ -dependent lipid binding domain. ( A ) Western blot from extracts of COS cells transfected with a PLCγ1 expression vector (50 μg), and from extracts of 50 mouse eggs, probed with the anti-PLCγ1bd antibody, described in the Materials and Methods section, and used for the microinjection experiments shown in Table . ( B ) Bacterial fusion proteins containing different PLCγ1 domains used for the experiments shown in Table . The Coomassie blue staining of a 10% SDS-PAGE gel loaded with affinity-purified GST fusion proteins is shown on the right: lane 1 , GST; lane 2 , GST-PLCγ1-SH2SH2SH3; lane 3 , GST-PLCγ1-SH2SH2; lane 4 , GST-PLCγ1-SH3.

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Expressing, Microinjection, Binding Assay, Western Blot, Transfection, Plasmid Preparation, Staining, SDS Page, Affinity Purification

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: A GST-PLCγl-SH3 Domain Fusion Protein Specifically Inhibits Tr-kit–induced Parthenogenetic Activation of Mouse Eggs

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Activation Assay

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: The SH3 domain, and not the SH2 domains, of PLCγ1 inhibits tr-kit–induced cortical granules exocytosis and pronuclear formation in mouse eggs. Eggs were co-injected with cell extracts (200 μg/ml) containing recombinant tr-kit and 500 μg/ml (final concentration in the egg: ∼10 μg/ml) of either GST-PLCγ1-SH3 ( A ) or GST-PLCγ1-SH2SH2 ( B ) and fixed 4 h after injection. Tr-kit–induced cortical granule reaction was inhibited by co-injection of GST-PLCγ1-SH3, but not by GST-PLCγ1-SH2SH2, with a similar rate as for pronuclear formation (see Table ) in three separate experiments. Double staining of chromatin (Hoechst dye) and cortical granules (TRITC-labeled lectin) was performed as described under Materials and Methods. Bar, 30 μm.

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Injection, Recombinant, Concentration Assay, Double Staining, Labeling

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: Antibodies Against the SH Region of PLCγ1 Inhibit Tr-kit–induced Parthenogenetic Activation of Mouse Eggs

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Activation Assay

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: Tr-kit stimulates DAG and InsP production in COS cells coexpressing PLCγ1. Cells were transfected with the indicated expression vectors and labeled with either [ 3 H]arachidonic acid ( A ) or [ 3 H]inositol ( B ) and processed as described under Materials and Methods. ( A ) DAG content was measured as cpm incorporated in DAG versus 10 3 cpm incorporated in total lipids. ( B ) InsPs content was measured as cpm incorporated into InsPs per mg protein 24 h after transfection. The data represent the mean ± SD of three separate experiments, each performed in triplicate. ( C ) Pellets obtained after TCA precipitation of representative samples analyzed for InsP production were resuspended in SDS-PAGE sample buffer and analyzed in Western blot (50 μg in each lane) by using either anti-PLCγ1bd or anti-kit antibodies.

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Transfection, Expressing, Labeling, TCA Precipitation, SDS Page, Western Blot

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: Tr-kit does not stably associate with PLCγ1. ( A ) COS cells were transfected with no DNA ( mock ), or 20 μg/dish pCMV5-c-kit ( c-kit ), or 20 μg/dish pCMV5-tr-kit ( tr-kit ). C-kit–transfected cells were incubated for the final 10 min with or without 100 ng/ml SCF. Cell extracts were either analyzed immediately in Western blot (50 μg in each lane) with an anti-kit antibody ( right side of the panel ), or incubated for 2 h with a GST-PLCγ1-SH2SH2SH3 fusion protein linked to glutathione–agarose beads. Proteins bound to the beads were eluted as described under Materials and Methods and analyzed in Western blot using an anti-kit antibody ( left side of the panel ). ( B ) Cells were transfected as described in A with tr-kit or c-kit expression vectors. Cell extracts were immunoprecipitated using an anti-kit antibody preadsorbed to protein A–Sepharose beads. Immunoprecipitated proteins were analyzed in Western blot using an anti-phosphotyrosine antibody. The band recognized by the anti-phosphotyrosine antibody with a molecular size similar to the one expected for tr-kit is present in all the samples, regardless of tr-kit presence, indicating that this band is due to a different tyrosine-phosphorylated protein present in the anti-kit immunoprecipitates from COS cells. ( C ) Cell extracts (50 μg) from the same samples shown in B were analyzed in Western blot using an anti-kit antibody. All panels are representative of at least three separate experiments.

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Stable Transfection, Transfection, Incubation, Western Blot, Expressing, Immunoprecipitation

Journal: The Journal of Cell Biology

Article Title: Involvement of Phospholipase Cγ1 in Mouse Egg Activation Induced by a Truncated Form of the C-kit Tyrosine Kinase Present in Spermatozoa

doi:

Figure Lengend Snippet: Tr-kit stimulates tyrosine phosphorylation of PLCγ1 in transfected COS cells. Cells were transfected with a PLCγ1 expression vector, either alone or together with the tr-kit expression vector. ( A ) Cell extracts were immunoprecipitated using a mixture of anti-PLCγ1 antibodies (see Materials and Methods). Immunoprecipitated proteins were analyzed in Western blot using either the anti-PLCγ1bd antibody ( αPLCγ1 , left panel ) or an anti-phosphotyrosine antibody ( αPY , right panel ). These images are representative of six separate experiments, which gave similar results. ( B ) Western blot analysis with anti-PLCγ1 antibody ( αPLCγ1 ) and anti-phosphotyrosine antibody ( αPY ) of total cell extracts (50 μg in each lane) from PLCγ1- and PLCγ1/tr-kit– transfected COS cells.

Article Snippet: Plasmid DNAs encoding for GST fusion proteins of bovine PLCγ1 SH2–SH2 and human PLCγ1 SH3 (see Fig. ) in pGEX2T′6 were a kind gift from S. Courtneidge (Sugen, Inc., Redwood City, CA).

Techniques: Phospho-proteomics, Transfection, Expressing, Plasmid Preparation, Immunoprecipitation, Western Blot

Journal: Stem Cells (Dayton, Ohio)

Article Title: Calcium and Calcineurin-NFAT Signaling Regulate Granulocyte-Monocyte Progenitor Cell Cycle via Flt3-L

doi: 10.1002/stem.1813

Figure Lengend Snippet: Flt3-L triggers signaling leading to nuclear factor of activated T cells (NFAT) translocation in granulocyte–monocyte progenitors (GMPs). (A): Levels of intracellular Ca 2+ measured as Fluo4 fluorescence in sorted lin − Sca1 + cKIT + bone marrow (BM) cells (LSKs), common myeloid progenitors (CMPs), and GMPs. After 20 seconds of measurements cells were triggered with FLT3-L, ionomycin, thapsigargin, or Hanks' balanced salt solution (HBSS), and Ca 2+ levels were assessed for another 5 minutes. (B): Intracellular Ca 2+ chelator BAPTA was used to block Ca 2+ release induced by FLT3-L in sorted GMPs. (C): Flt3-L induces Ca 2+ release in GMPs sorted as lin − , cKit + , Sca-1 − , CD34 + , CD16/32 high . Graph of Ca 2+ release analysis in GMPs from lineage-depleted BM cells. Flt3-L (1μg/ml) was added after 1 minute of measurement followed by 4 minutes Ca 2+ release measurement. Representative of three independent experiments, where BM cells from five mice were pooled. (D): Different levels of phospholipase Cγ (PLCγ 2 ) phosphorylation (pPLCγ 2 ) in LSKs (pool of hematopoietic stem cell [HSCs] and multipotent progenitors [MPPs]; lin − , cKit + , Sca-1 + ), CMPs, and GMPs in freshly isolated BM. (E–G): Different levels of pPLCγ 1 in progenitor populations before and after Flt3-L administration. Lineage-depleted BM cells were cultured for 4 hours in HSC medium, Flt3-L (1 μg/ml) was added 15 minutes before fixing and labeling with antibodies for progenitor markers, PLCγ 1 and pPLCγ 2 . Cells were gated as LSKs (pool of HSCs and MPPs; lin − , cKit + , Sca-1 + ), CMPs (lin − , cKit + , Sca-1 − , CD34 + , CD16/32 int ), and GMPs (lin − , cKit + , Sca-1 − , CD34 + , CD16/32 high ). (E, F): Percentage of pPLCγ 1 cells and Gm of fluorescence of pPLCγ 1 and double labeling of total PLCγ 1 with pPLCγ 1 upon trigger with Flt3-L are shown. Data are presented as mean ± SE, *, p < .05 and **, p < .01 in an unpaired Student's t -test. (G): Histogram overlay of pPLCγ 1 intensity in GMPs after the Flt3-L trigger. Representative experiment from three independent experiments is shown. (H): Flt3-L induces NFAT translocation in cKIT + -enriched BM cells. BM cells were depleted of lineaged cells and enriched with cKIT + beads, maintained in HSC medium and transduced with NFAT reporter constructs. Transfected cells were kept in HSC medium for 48 hours, and 1 μg/ml of Flt3-L was added for last 4 hours of culture before nuclear translocation of NFAT reflecting activity of luciferase reporter gene was measured. Data are presented as mean ± SE from one representative of three independent experiments, *, p < .05 in an unpaired Student's t -test. BM pooled from 10 mice was used for each experiment. (I): Proposed graphical scheme of cell cycle regulation in GMPs. Flt3-L activates PLCγ 1 and induce increase in intracellular Ca 2+ levels, this further activates calcineurin and NFAT translocation. When calcineurin-NFAT interaction is blocked, expression of cell cycle regulation genes in GMPs is changed to promote further proliferation. Abbreviations: CMP, common myeloid progenitors; CsA, Cyclosporine A; FITC, fluorescein isothiocyanate; GMP, granulocyte–monocyte progenitor; HBSS, Hanks' balanced salt solution; LSK, lin − Sca1 + cKIT + bone marrow cells; NFAT, nuclear factor of activated T cells; NT, non-treated; PLC, phospholipase Cγ.

Article Snippet: Progenitor subsets were labeled with antibodies, cells were fixed and incubated with anti-pPLCγ 1 -FITC and total PLCγ 1 -PE and analyzed using the FlowCellect PLCγ 1 Activation Dual Detection Kit (Merck Millipore, Billerica, MA, www.emdmillipore.com ) according to manufacturer's instructions.

Techniques: Translocation Assay, Fluorescence, Blocking Assay, Isolation, Cell Culture, Labeling, Transduction, Construct, Transfection, Activity Assay, Luciferase, Expressing